pORF1-2
(Plasmid
#206024)
-
PurposeAn expression vector for mouse LINE1 ORF1-2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206024 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZeoSV2(+)
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameORF1-2 derived from mouse LINE1
-
SpeciesM. musculus (mouse)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TATTTATGCAGAGGCCGAGG
- 3′ sequencing primer CCTCACATTGCCAAAAGACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pORF1-2 was a gift from Masamichi Kamihira (Addgene plasmid # 206024 ; http://n2t.net/addgene:206024 ; RRID:Addgene_206024) -
For your References section:
LINE-1 vectors mediate recombinant antibody gene transfer by retrotransposition in Chinese hamster ovary cells. Zheng F, Kawabe Y, Murakami M, Takahashi M, Nishihata K, Yoshida S, Ito A, Kamihira M. Biotechnol J. 2021 Jul;16(7):e2000620. doi: 10.1002/biot.202000620. Epub 2021 May 20. 10.1002/biot.202000620 PubMed 33938150