pLINE1ΔORF1-2-scFvFc
(Plasmid
#206022)
-
PurposeThe ORF1 and ORF2 sequences were removed from pLINE1-scFvFc
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206022 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCEP4
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse LINE1 vector harboring an scFv-Fc expression unit, lacking the ORF1 and ORF2 sequences
-
SpeciesH. sapiens (human), M. musculus (mouse), G. gallus (chicken)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CCGACTGCATCTGCGTGTTC
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLINE1ΔORF1-2-scFvFc was a gift from Masamichi Kamihira (Addgene plasmid # 206022 ; http://n2t.net/addgene:206022 ; RRID:Addgene_206022) -
For your References section:
LINE-1 vectors mediate recombinant antibody gene transfer by retrotransposition in Chinese hamster ovary cells. Zheng F, Kawabe Y, Murakami M, Takahashi M, Nishihata K, Yoshida S, Ito A, Kamihira M. Biotechnol J. 2021 Jul;16(7):e2000620. doi: 10.1002/biot.202000620. Epub 2021 May 20. 10.1002/biot.202000620 PubMed 33938150