pAAV_hSyn_WiChR_TS_mScarlet_ER
(Plasmid #205997)

• Purpose: High efficient, K+ selective channelrhodopsin for the inhibition of neurons
• Depositing Labs: Peter Hegemann, Johannes Vierock
• Publication: Vierock et al Sci Adv. 2022 Nov 16:eadd7729.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Wobblia Inhibitory Channelrhodopsin
• Alt name: WiChR, WlChR1
• Species: Wobblia lunata
• GenBank ID: OP710241.1 UZU83954.1
• Promoter: hSyn
• Tag / Fusion Protein:
  • TS, mScarlet, ER

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhe1 (unknown if destroyed)
• 3′ cloning site: xho1 (unknown if destroyed)
• 5′ sequencing primer: ggcagcggaggagtcgtgtc
• 3′ sequencing primer: cgctatgtggatacgctgctttaatg

Resource Information

• Supplemental Documents:
  • paav_hsyn_wichr_ts_mscarlet_er.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry