Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV_hSyn_WiChR_TS_mScarlet_ER
(Plasmid #205997)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205997 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Wobblia Inhibitory Channelrhodopsin
  • Alt name
    WiChR, WlChR1
  • Species
    Wobblia lunata
  • GenBank ID
    OP710241.1 UZU83954.1
  • Promoter hSyn
  • Tag / Fusion Protein
    • TS, mScarlet, ER

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (unknown if destroyed)
  • 3′ cloning site xho1 (unknown if destroyed)
  • 5′ sequencing primer ggcagcggaggagtcgtgtc
  • 3′ sequencing primer cgctatgtggatacgctgctttaatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_hSyn_WiChR_TS_mScarlet_ER was a gift from Peter Hegemann & Johannes Vierock (Addgene plasmid # 205997 ; http://n2t.net/addgene:205997 ; RRID:Addgene_205997)
  • For your References section:

    WiChR, a highly potassium selective channelrhodopsin for low-light one- and two-photon inhibition of excitable cells. Vierock J, Peter E, Grimm C, Rozenberg A, Chen IW, Tillert L, Castro Scalise AG, Casini M, Augustin S, Tanese D, Forget BC, Peyronnet R, Schneider-Warme F, Emiliani V, Beja O, Hegemann P. Sci Adv. 2022 Nov 16:eadd7729. 10.1126/sciadv.add7729 PubMed 36383037