pLV-CMV-KIF2C
(Plasmid #205994)

• Purpose: Over-expression of GFP-KIF2c
• Depositing Lab: Floris Foijer
• Publication: Hong et al Nature. 2022 Jul;607(7918):366-373. doi: 10.1038/s41586-022-04847-2. Epub 2022 Jun 15.

Backbone

• Vector backbone: pLVX
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 8134
• Total vector size (bp): 11089
• Modifications to backbone: Replaced pTight-promoter by CMV-promoter
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KIF2c
• Species: H. sapiens (human)
• Insert Size (bp): 2178
• GenBank ID: NM_006845.4
• Entrez Gene: KIF2C (a.k.a. CT139, KNSL6, MCAK)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: AAGCGCCTCCCCTACCCGGT

Resource Information

• Supplemental Documents:
  • pLV-CMV-KIF2C.gb
• A portion of this plasmid was derived from a plasmid made by: Bakhoum, S. F.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Bakhoum, S. F. et al. Chromosomal instability drives metastasis through a cytosolic DNA
response. Nature 553, 467–472 (2018).