pX330-Venus-DNAJC5-Exon 4-gRNA
(Plasmid
#205726)
-
PurposeKnockout of DNAJC5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205726 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330-Venus
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting DNAJC5 exon 4
-
gRNA/shRNA sequenceCACCGGAGGCCGCAGAAGACAAACA
-
SpeciesH. sapiens (human)
-
Entrez GeneDNAJC5 (a.k.a. CLN4, CLN4B, CSP, DNAJC5A, NCL, mir-941-2, mir-941-3, mir-941-4, mir-941-5)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-Venus-DNAJC5-Exon 4-gRNA was a gift from Randy Schekman (Addgene plasmid # 205726) -
For your References section:
Unconventional secretion of alpha-synuclein mediated by palmitoylated DNAJC5 oligomers. Wu S, Hernandez Villegas NC, Sirkis DW, Thomas-Wright I, Wade-Martins R, Schekman R. Elife. 2023 Jan 10;12:e85837. doi: 10.7554/eLife.85837. 10.7554/eLife.85837 PubMed 36626307