pKM-U6-reRNA-mmSCN9A
(Plasmid
#205636)
-
PurposereRNA guide targeting Mus Musculus SCN9A
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205636 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKM-U6-reRNA-acceptor-2xBbsI
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namereRNA-mmSCN9A
-
gRNA/shRNA sequenceatcaccatcatggttcttat
-
SpeciesM. musculus (mouse)
-
Entrez GeneScn9a (a.k.a. Nav1.7, PN1, mKIAA4197)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKM-U6-reRNA-mmSCN9A was a gift from Gerald Schwank (Addgene plasmid # 205636 ; http://n2t.net/addgene:205636 ; RRID:Addgene_205636) -
For your References section:
Effective genome editing with an enhanced ISDra2 TnpB system and deep learning-predicted omegaRNAs. Marquart KF, Mathis N, Mollaysa A, Muller S, Kissling L, Rothgangl T, Schmidheini L, Kulcsar PI, Allam A, Kaufmann MM, Matsushita M, Haenggi T, Cathomen T, Kopf M, Krauthammer M, Schwank G. Nat Methods. 2024 Sep 23. doi: 10.1038/s41592-024-02418-z. 10.1038/s41592-024-02418-z PubMed 39313558