Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FSHB-t2a-dTOMATO
(Plasmid #205597)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205597 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLV
  • Backbone size w/o insert (bp) 6700
  • Total vector size (bp) 8104

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FSHB
  • Alt name
    follicle stimulating hormone
  • Species
    Nothobranchius furzeri
  • Insert Size (bp)
    351
  • Promoter CMV
  • Tag / Fusion Protein
    • dTOMATO (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGATCGCGGGCATGAACT
  • 3′ sequencing primer ACCACACTCATCCACACCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FSHB-t2a-dTOMATO was a gift from Itamar Harel (Addgene plasmid # 205597 ; http://n2t.net/addgene:205597 ; RRID:Addgene_205597)
  • For your References section:

    A scalable and tunable platform for functional interrogation of peptide hormones in fish. Moses E, Franek R, Harel I. Elife. 2023 Oct 24;12:e85960. doi: 10.7554/eLife.85960. 10.7554/eLife.85960 PubMed 37872843