FSHB-t2a-dTOMATO
(Plasmid
#205597)
-
Purposean overexpression vector of the killifish FSHB
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205597 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV
- Backbone size w/o insert (bp) 6700
- Total vector size (bp) 8104
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFSHB
-
Alt namefollicle stimulating hormone
-
SpeciesNothobranchius furzeri
-
Insert Size (bp)351
- Promoter CMV
-
Tag
/ Fusion Protein
- dTOMATO (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGATCGCGGGCATGAACT
- 3′ sequencing primer ACCACACTCATCCACACCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FSHB-t2a-dTOMATO was a gift from Itamar Harel (Addgene plasmid # 205597 ; http://n2t.net/addgene:205597 ; RRID:Addgene_205597) -
For your References section:
A scalable and tunable platform for functional interrogation of peptide hormones in fish. Moses E, Franek R, Harel I. Elife. 2023 Oct 24;12:e85960. doi: 10.7554/eLife.85960. 10.7554/eLife.85960 PubMed 37872843