pAAV-CMV-flex-Unc5cHA-WPRE-SV40pA
(Plasmid
#205442)
-
Purposeproduction of AAV for cre-dependent expression of Unc5C, tagged with 3xHA at C-terminus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 7526
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUnc5c
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2793
-
Entrez GeneUnc5c (a.k.a. B130051O18Rik, Unc5h3, rcm)
- Promoter mini-CMV (with MVM small intron)
-
Tag
/ Fusion Protein
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer TGGAGCACCTGCCTGAAATCACTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byUnc5c cDNA was provided by Dr. Woj Wojtowicz (UC Berkeley). Other plasmid components provided by Dr. Boris Kantor (Duke University).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.08.29.505771 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-flex-Unc5cHA-WPRE-SV40pA was a gift from Jeremy Kay (Addgene plasmid # 205442 ; http://n2t.net/addgene:205442 ; RRID:Addgene_205442) -
For your References section:
Rejection of inappropriate synaptic partners in mouse retina mediated by transcellular FLRT2-UNC5 signaling. Prigge CL, Dembla M, Sharma A, El-Quessny M, Kozlowski C, Paisley CE, Miltner AM, Johnson TM, Della Santina L, Feller MB, Kay JN. Dev Cell. 2023 Oct 23;58(20):2080-2096.e7. doi: 10.1016/j.devcel.2023.07.011. Epub 2023 Aug 8. 10.1016/j.devcel.2023.07.011 PubMed 37557174