pAAV-CMV-flex-Unc5cHA-WPRE-SV40pA
(Plasmid #205442)

• Purpose: production of AAV for cre-dependent expression of Unc5C, tagged with 3xHA at C-terminus
• Depositing Lab: Jeremy Kay
• Publication: Prigge et al Dev Cell. 2023 Oct 23;58(20):2080-2096.e7. doi: 10.1016/j.devcel.2023.07.011. Epub 2023 Aug 8.

Backbone

• Vector backbone: pAAV
• Total vector size (bp): 7526
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Unc5c
• Species: M. musculus (mouse)
• Insert Size (bp): 2793
• Entrez Gene: Unc5c (a.k.a. B130051O18Rik, Unc5h3, rcm)
• Promoter: mini-CMV (with MVM small intron)
• Tag / Fusion Protein:
  • 3xHA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: TGGAGCACCTGCCTGAAATCACTT

Resource Information

• Supplemental Documents:
  • pBK1572 AAV-flex-Unc5c Kay v4 Final.gb
• A portion of this plasmid was derived from a plasmid made by: Unc5c cDNA was provided by Dr. Woj Wojtowicz (UC Berkeley). Other plasmid components provided by Dr. Boris Kantor (Duke University).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2022.08.29.505771 for bioRxiv preprint.