Skip to main content
Addgene

pChlamy/Cre
(Plasmid #205440)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205440 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluscript II SK(+)
  • Backbone manufacturer
    Stratagene
  • Vector type
    Chlamydomonas Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre recombinase gene
  • Alt name
    Cre
  • Promoter Heat shock protein 70A (HSP70A)/ribulose bisphosphate carboxylase small subunit 2 (RBCS2) hybrid promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer AGCGGATAACAATTTCACACAGG
  • 3′ sequencing primer CCCAGTCACGACGTTGTAAAACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pChlamy/Cre was a gift from Masamichi Kamihira (Addgene plasmid # 205440 ; http://n2t.net/addgene:205440 ; RRID:Addgene_205440)
  • For your References section:

    Novel transgenic Chlamydomonas reinhardtii strain with retargetable genomic transgene integration using Cre-loxP system. Huang G, Kawabe Y, Shirakawa K, Akiyama T, Kamihira M. J Biosci Bioeng. 2021 Nov;132(5):469-478. doi: 10.1016/j.jbiosc.2021.07.006. Epub 2021 Aug 19. 10.1016/j.jbiosc.2021.07.006 PubMed 34420898