Skip to main content
Addgene

pD/Paro-IFN
(Plasmid #205439)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205439 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMC
  • Backbone manufacturer
    System Biosciences
  • Vector type
    Cre/Lox ; Chlamydomonas Expression
  • Selectable markers
    paromomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    dog interferon α-4 gene
  • Alt name
    IFNα-4
  • Species
    dog
  • Promoter Heat shock protein 70A (HSP70A)/ribulose bisphosphate carboxylase small subunit 2 (RBCS2) hybrid promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer CAGAAGGAGCGCAGCCAAAC
  • 3′ sequencing primer TCCACAACAACCCACTCACAACC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    paromomycin resistance gene
  • Alt name
    Paro

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstBI (unknown if destroyed)
  • 3′ cloning site ApaI (unknown if destroyed)
  • 5′ sequencing primer CGGCCGCAGCTTCTTCTCTTTAACC
  • 3′ sequencing primer CGTTGGCTACCCGTGATATT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pD/Paro-IFN was a gift from Masamichi Kamihira (Addgene plasmid # 205439 ; http://n2t.net/addgene:205439 ; RRID:Addgene_205439)

  • For your References section:

    Novel transgenic Chlamydomonas reinhardtii strain with retargetable genomic transgene integration using Cre-loxP system. Huang G, Kawabe Y, Shirakawa K, Akiyama T, Kamihira M. J Biosci Bioeng. 2021 Nov;132(5):469-478. doi: 10.1016/j.jbiosc.2021.07.006. Epub 2021 Aug 19. 10.1016/j.jbiosc.2021.07.006 PubMed 34420898
Related items:
Commonly requested with: