Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHR-LS
(Plasmid #205438)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205438 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluescript II KS (+)
  • Backbone manufacturer
    Stratagene
  • Vector type
    Cre/Lox, Luciferase ; Chlamydomonas Expression
  • Selectable markers
    spectinomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Gaussia luciferase gene
  • Alt name
    gLuc
  • Promoter Heat shock protein 70A (HSP70A)/ribulose bisphosphate carboxylase small subunit 2 (RBCS2) hybrid promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site SpeI (unknown if destroyed)
  • 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG
  • 3′ sequencing primer CGTTCGCCTCCATTTCCTTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    spectinomycin resistance gene
  • Alt name
    Spec
  • Promoter Heat shock protein 70A (HSP70A)/ribulose bisphosphate carboxylase small subunit 2 (RBCS2) hybrid promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer TGGTCTCCAGCAGGTCGTTG
  • 3′ sequencing primer AGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-LS was a gift from Masamichi Kamihira (Addgene plasmid # 205438 ; http://n2t.net/addgene:205438 ; RRID:Addgene_205438)
  • For your References section:

    Novel transgenic Chlamydomonas reinhardtii strain with retargetable genomic transgene integration using Cre-loxP system. Huang G, Kawabe Y, Shirakawa K, Akiyama T, Kamihira M. J Biosci Bioeng. 2021 Nov;132(5):469-478. doi: 10.1016/j.jbiosc.2021.07.006. Epub 2021 Aug 19. 10.1016/j.jbiosc.2021.07.006 PubMed 34420898