dCas9-RPT6-FLAG
(Plasmid
#205416)
-
PurposeExpresses dCas9-RPT6 with FLAG label
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonedCas9-KRAB-MeCP2
-
Backbone manufacturerAddgene plasmid #110821
- Backbone size w/o insert (bp) 7085
- Total vector size (bp) 8671
-
Modifications to backboneRemoved MeCP2 and replaced with RPT6 and FLAG
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-RPT6
-
Alt namePsmc5
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1215
-
Entrez GenePsmc5 (a.k.a. Sug1)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Ascl (not destroyed)
- 3′ cloning site Agel (not destroyed)
- 5′ sequencing primer GACGCTAACCTCGATAAGGTGCTTTC (5` --> 3`)
- 3′ sequencing primer GAACAAACGACCCAACACCCG (5` --> 3`) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dCas9-RPT6-FLAG was a gift from Timothy Jarome (Addgene plasmid # 205416 ; http://n2t.net/addgene:205416 ; RRID:Addgene_205416) -
For your References section:
Phosphorylation of RPT6 Controls Its Ability to Bind DNA and Regulate Gene Expression in the Hippocampus of Male Rats during Memory Formation. Farrell K, Auerbach A, Musaus M, Navabpour S, Liu C, Lin Y, Xie H, Jarome TJ. J Neurosci. 2024 Jan 24;44(4):e1453232023. doi: 10.1523/JNEUROSCI.1453-23.2023. 10.1523/JNEUROSCI.1453-23.2023 PubMed 38124005