Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSBtet-2xMARS-nGFP-puro
(Plasmid #205239)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205239 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSBtet-Pur
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 7634
  • Modifications to backbone
    Replace the firefly luciferase in the original vector plasmid with current insert
  • Vector type
    Mammalian Expression ; transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2xPLEKHA5(143-271)-K163A/R164A-HA-nGFP
  • Alt name
    PEPP2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1293
  • Mutation
    amino acids 143-271 of PLEKHA5 (GenBank reference sequence NM_001256470.2) with K163A and R164A mutations
  • GenBank ID
    NM_001256470.2
  • Entrez Gene
    PLEKHA5 (a.k.a. PEPP-2, PEPP2)
  • Promoter tight TRE promoter
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • nGFP (GFP nanobody) (C terminal on insert)
    • mScarlet-i (C terminal on insert)
    • Nuclear Export Sequence (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TRE forward (AGCTCGTTTAGTGAACCGTCAG)
  • 3′ sequencing primer SV40 polyA reverse (CAATAGCATCACAAATTTCACAAATAAAGC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBtet-2xMARS-nGFP-puro was a gift from Jeremy Baskin (Addgene plasmid # 205239 ; http://n2t.net/addgene:205239 ; RRID:Addgene_205239)