pCDH-2xMARS-nGFP-puro
(Plasmid #205238)

• Purpose: Lentiviral vector encoding two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to a HA-tagged GFP nanobody
• Depositing Lab: Jeremy Baskin
• Publication: A phosphorylation-controlled switch confers cell cycle-dependent protein relocalization (unpublished)

Backbone

• Vector backbone: pCDH-CMV-MCS-EF1-Puro
• Backbone size w/o insert (bp): 7368
• Total vector size (bp): 9427
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 2xPLEKHA5(143-271)-K163A/R164A-HA-nGFP
• Alt name: PEPP2
• Species: H. sapiens (human)
• Insert Size (bp): 1293
• Mutation: amino acids 143-271 of PLEKHA5 (GenBank reference sequence NM_001256470.2) with K163A and R164A mutations
• GenBank ID: NM_001256470.2
• Entrez Gene: PLEKHA5 (a.k.a. PEPP-2, PEPP2)
• Promoter: CMV
• Tags / Fusion Proteins:
  • HA (C terminal on insert)
  • nGFP (GFP nanobody) (C terminal on insert)
  • mScarlet-i (C terminal on insert)
  • Nuclear Export Sequence (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV forward
• 3′ sequencing primer: pCDH-Rev (tcggcaattgaacgggtgcctaga)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry