Lenti-UbC-LARGE1-EF1a-BSD
(Plasmid
#205151)
-
PurposeExpress UbC-driven LARGE1 and EF-1a driven BSD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205151 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCas9-Blast
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 9813
- Total vector size (bp) 12084
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLARGE xylosyl- and glucuronyltransferase 1
-
Alt nameLARGE1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2271
-
GenBank IDNM_004737
-
Entrez GeneLARGE1 (a.k.a. LARGE, MDC1D, MDDGA6, MDDGB6)
- Promoter UbC
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcggttcttgtttgtggat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-UbC-LARGE1-EF1a-BSD was a gift from Monkol Lek (Addgene plasmid # 205151 ; http://n2t.net/addgene:205151 ; RRID:Addgene_205151)