Lenti-UbC-LARGE1-EF1a-BSD
(Plasmid #205151)

• Purpose: Express UbC-driven LARGE1 and EF-1a driven BSD
• Depositing Lab: Monkol Lek
• Publication: Using Saturation Mutagenesis-Reinforced Functional Assays (SMuRF) to improve the variant interpretation for alpha-dystroglycan glycosylation enzymes (unpublished)

Backbone

• Vector backbone: lentiCas9-Blast
• Backbone manufacturer: Feng Zhang
• Backbone size w/o insert (bp): 9813
• Total vector size (bp): 12084
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LARGE xylosyl- and glucuronyltransferase 1
• Alt name: LARGE1
• Species: H. sapiens (human)
• Insert Size (bp): 2271
• GenBank ID: NM_004737
• Entrez Gene: LARGE1 (a.k.a. LARGE, MDC1D, MDDGA6, MDDGB6)
• Promoter: UbC

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgcggttcttgtttgtggat

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry