pTY186 EGFP-T2A-ALFA-ORF6 SARS-CoV-2
(Plasmid
#204976)
-
PurposeCo-express EGFP and SARS-CoV-2 ORF6 N-terminally labeled with ALFA tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204976 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSectag2
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6044
-
Modifications to backboneEGFP-T2A inserted at the N-terminus of ALFA-ORF6
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOpen Reading Frame 6
-
SpeciesSARS-CoV-2
-
Insert Size (bp)186
-
Entrez GeneORF6 (a.k.a. GU280_gp06)
- Promoter CMV
-
Tag
/ Fusion Protein
- ALFA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTY186 EGFP-T2A-ALFA-ORF6 SARS-CoV-2 was a gift from Tim Mitchison (Addgene plasmid # 204976 ; http://n2t.net/addgene:204976 ; RRID:Addgene_204976) -
For your References section:
Quantitative comparison of nuclear transport inhibition by SARS coronavirus ORF6 reveals the importance of oligomerization. Yoo TY, Mitchison TJ. Proc Natl Acad Sci U S A. 2024 Jan 23;121(4):e2307997121. doi: 10.1073/pnas.2307997121. Epub 2024 Jan 18. 10.1073/pnas.2307997121 PubMed 38236733