raACR-TS-Kv-P2A-mCerulean3-pAAV-CaMKII
(Plasmid #204971)

• Purpose: Soma-targeted neuronal expression of the MsACR1 mutant raACR and mCerulean3 separated by a P2A site.
• Depositing Lab: Peter Hegemann
• Publication: Oppermann et al eLife 2023 (Reviewed Preprint)

Backbone

• Vector backbone: pAAV2-CaMKII
• Backbone size w/o insert (bp): 3785
• Total vector size (bp): 5582
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: raACR
• Alt name: MsACR1-S218A
• Species: Mantoniella squamata
• Insert Size (bp): 723
• Promoter: CaMKII
• Tag / Fusion Protein:
  • mCerulean3 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CaMKII-fwd: gtggcccctagttctgggggcag
• 3′ sequencing primer: WPRE-rev: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • 295_raACR-TS-Kv-P2A-mCerulean.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.06.09.544329 for bioRxiv preprint.