Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

S16-ACR1-pcDNA3.1-mScarlet
(Plasmid #204963)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204963 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5448
  • Total vector size (bp) 7179
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    S16-ACR1
  • Species
    unknown
  • Insert Size (bp)
    930
  • Promoter CMV (+ enhancer)
  • Tag / Fusion Protein
    • mScarlet (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV-fwd: GCAAATGGGCGGTAGGCGT
  • 3′ sequencing primer EGFP-C1-rev: AACCATTATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.06.09.544329 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    S16-ACR1-pcDNA3.1-mScarlet was a gift from Peter Hegemann (Addgene plasmid # 204963 ; http://n2t.net/addgene:204963 ; RRID:Addgene_204963)
  • For your References section:

    Robust Optogenetic Inhibition with Red-light-sensitive Anion-conducting Channelrhodopsins. Oppermann J, Rozenberg A, Fabrin T, GonzalezCabrera C, Béjà O, Prigge M, Hegemann P. eLife 2023 (Reviewed Preprint) 10.7554/eLife.90100.1