raACR-pmCerulean3-N1
(Plasmid #204959)

• Purpose: Expression of the MsACR1 mutant raACR as a fusion protein with mCerulean3 in mammalian cells
• Depositing Lab: Peter Hegemann
• Publication: Oppermann et al eLife 2023 (Reviewed Preprint)

Backbone

• Vector backbone: pEGFP-C1
• Backbone size w/o insert (bp): 3987
• Total vector size (bp): 5427
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: raACR
• Alt name: MsACR1-S218A
• Species: Mantoniella squamata
• Insert Size (bp): 723
• Promoter: CMV (+enhancer)
• Tag / Fusion Protein:
  • mCerulean3 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV-fwd: GCAAATGGGCGGTAGGCGT
• 3′ sequencing primer: EGFP-C1-rev: AACCATTATAAGCTGCAATAAAC

Resource Information

• Supplemental Documents:
  • 263_raACR_mCerulean.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.06.09.544329 for bioRxiv preprint.