pU6-PspCas13b-GEMSgRNA2
(Plasmid
#204768)
-
PurposepU6-PspCas13b-gRNA-Actb1216 backbone (Addgene ID: 155368) containing guide RNA #2 targeting the GEMS m6A reporter mRNA sequence.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204768 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepU6-PspCas13b-gRNA
- Backbone size w/o insert (bp) 2940
- Total vector size (bp) 2970
-
Modifications to backboneadd gRNA sequence downstream of U6 promoter
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameguide RNA targeting GEMS m6A sensor mRNA
-
gRNA/shRNA sequenceCCGCCGCATCTAACACATTGATCCTAGCAG
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caggaaacagctatgac
- 3′ sequencing primer tgtaaaacgacggccagt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-PspCas13b-GEMSgRNA2 was a gift from Kate Meyer (Addgene plasmid # 204768 ; http://n2t.net/addgene:204768 ; RRID:Addgene_204768) -
For your References section:
Programmable protein expression using a genetically encoded m(6)A sensor. Marayati BF, Thompson MG, Holley CL, Horner SM, Meyer KD. Nat Biotechnol. 2024 Jan 2. doi: 10.1038/s41587-023-01978-3. 10.1038/s41587-023-01978-3 PubMed 38168988