Skip to main content
Addgene

p186-RV-CAG-dio-mScarlet-T2A-mVenus
(Plasmid #204740)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204740 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p185-RV-CAG-dio-mScarlet-T2A
  • Total vector size (bp) 8609
  • Modifications to backbone
    addition of mVenus sequence
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mVenus
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site PacI (unknown if destroyed)
  • 5′ sequencing primer AGCGTTCGTACTGTTCCACC
  • 3′ sequencing primer ttacttgtacagctcgtccatgccg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p186-RV-CAG-dio-mScarlet-T2A-mVenus was a gift from Lynette Lim (Addgene plasmid # 204740 ; http://n2t.net/addgene:204740 ; RRID:Addgene_204740)
  • For your References section:

    Cortical somatostatin long-range projection neurons and interneurons exhibit divergent developmental trajectories. Fisher J, Verhagen M, Long Z, Moissidis M, Yan Y, He C, Wang J, Micoli E, Alastruey CM, Moors R, Marin O, Mi D, Lim L. Neuron. 2023 Dec 7:S0896-6273(23)00887-5. doi: 10.1016/j.neuron.2023.11.013. 10.1016/j.neuron.2023.11.013 PubMed 38086373