p164-pAAV-mDlx-FLEX-mScarlet
(Plasmid
#204689)
-
PurposeFluorescent reporter under the control of the Dlx promotor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-mDlx-dio
-
Backbone manufactureraddgene
- Backbone size w/o insert (bp) 4915
- Total vector size (bp) 5697
-
Modifications to backbonemScarlet fluorescent reporter added to the vector backbone
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemScarlet
-
Alt namemScarlet
-
SpeciesSynthetic
-
Insert Size (bp)770
- Promoter mDlx
-
Tag
/ Fusion Protein
- mScarlet palmitoylation (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (unknown if destroyed)
- 3′ cloning site FseI (unknown if destroyed)
- 5′ sequencing primer TTACTTGTACAGCTCGTCCATGC
- 3′ sequencing primer CCACCATGCTGTGCTGTATGAGAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
11bp sequence missing in AAV2 ITR sequence
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p164-pAAV-mDlx-FLEX-mScarlet was a gift from Lynette Lim (Addgene plasmid # 204689 ; http://n2t.net/addgene:204689 ; RRID:Addgene_204689) -
For your References section:
Cortical somatostatin long-range projection neurons and interneurons exhibit divergent developmental trajectories. Fisher J, Verhagen M, Long Z, Moissidis M, Yan Y, He C, Wang J, Micoli E, Alastruey CM, Moors R, Marin O, Mi D, Lim L. Neuron. 2023 Dec 7:S0896-6273(23)00887-5. doi: 10.1016/j.neuron.2023.11.013. 10.1016/j.neuron.2023.11.013 PubMed 38086373