PdnaK-IR3-IR3-Bxb1-CadR-pZa
(Plasmid
#204686)
-
PurposeCadmium responsive genetic circuit
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204686 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZa
- Backbone size w/o insert (bp) 2093
- Total vector size (bp) 3692
-
Modifications to backboneAddition of PdnaK promoter and IR3-IR3 operator sites.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBxb1
-
SpeciesSynthetic
-
Insert Size (bp)1127
-
Entrez GeneBxb1p45 (a.k.a. Bxb1p45)
- Promoter Inducible, HspR is its repressor
-
Tag
/ Fusion Protein
- CadR (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACGCCCGGTAGTGATCTTAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PdnaK-IR3-IR3-Bxb1-CadR-pZa was a gift from Urartu Seker (Addgene plasmid # 204686 ; http://n2t.net/addgene:204686 ; RRID:Addgene_204686) -
For your References section:
A Recombinase-Based Genetic Circuit for Heavy Metal Monitoring. Akboga D, Saltepe B, Bozkurt EU, Seker UOS. Biosensors (Basel). 2022 Feb 16;12(2):122. doi: 10.3390/bios12020122. 10.3390/bios12020122 PubMed 35200383