pLenti-CMV-paGFP-bPAC-CAAX
(Plasmid
#204671)
-
PurposeMammalian expression of membrane-bound bPAC tagged with paGFP for cAMP production
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 8538
- Total vector size (bp) 10410
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepaGFP-bPAC-CAAX
-
SpeciesSynthetic; Beggiatoa sp.
-
Insert Size (bp)1872
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agaagacaccgactctagaggatccATGGTGAGCAAGGGCGAG
- 3′ sequencing primer gaattctcacataattacacactttgtctttgacttctttttcttctttttaccaccggt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.27.546633v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CMV-paGFP-bPAC-CAAX was a gift from Adam Cohen (Addgene plasmid # 204671 ; http://n2t.net/addgene:204671 ; RRID:Addgene_204671) -
For your References section:
All-optical mapping of cAMP transport reveals rules of sub-cellular localization. Xiang KM, Park P, Koren SA, Hayward RF, Cohen AE. bioRxiv 2023 10.1101/2023.06.27.546633