pHB1
(Plasmid #204668)

• Purpose: pUC19 containing the LL-FRT-erm-FRT-spacer sequence which serves as template for BarSeq deletion constructs
• Depositing Lab: Mark Mandel
• Publication: Burgos et al mSystems. 2020 Dec 15;5(6):e00846-20. doi: 10.1128/mSystems.00846-20.

Backbone

• Vector backbone: pUC19
• Backbone size w/o insert (bp): 2686
• Total vector size (bp): 3660
• Modifications to backbone: The insert in pHB1 was constructed using a gBlock gene fragment from IDT (gHB1) encoding a custom Left Linker sequence (ACGAGACGAGCTTCTTATATATGCTTCGCCAG), an Erm-resistance cassette flanked by FRT sites, and a custom spacer sequence (AGCGCTCATGCACTTGATTCC). Oligos HB22 and HB23 were used to PCR amplify the gBlock flanked by HindIII and BamHI sites. This fragment was then cloned into pUC19 that was digested with HindIII/BamHI and treated with Antarctic Phosphatase. HB22: GGTCAGCCTCTAATGGCTCGTAAGATAGTG. HB23: TTGGAGAGCCAGCTGCGTTCGCTAA.
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FRT-erm-FRT
• Alt name: erythromycin resistance
• Alt name: flippase recognition target
• Insert Size (bp): 998

Resource Information

• Supplemental Documents:
  • pHB1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry