P17-pZE-SUMO-CsTTA
(Plasmid
#204631)
-
PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized csTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZE Vector
- Backbone size w/o insert (bp) 2915
- Total vector size (bp) 4609
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHis-SUMO-TEV-CsTTA
-
SpeciesSynthetic
-
Insert Size (bp)1695
- Promoter PLtetO-1 promoter
-
Tag
/ Fusion Protein
- His Tag; SUMO Tag; TEV Protease Site (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gagtccctatcagtgatagagattgac
- 3′ sequencing primer ccatgggatcccccatcaag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P17-pZE-SUMO-CsTTA was a gift from Aditya Kunjapur (Addgene plasmid # 204631 ; http://n2t.net/addgene:204631 ; RRID:Addgene_204631) -
For your References section:
Discovery of L-threonine transaldolases for enhanced biosynthesis of beta-hydroxylated amino acids. Jones MA, Butler ND, Anderson SR, Wirt SA, Govil I, Lyu X, Fang Y, Kunjapur AM. Commun Biol. 2023 Sep 11;6(1):929. doi: 10.1038/s42003-023-05293-0. 10.1038/s42003-023-05293-0 PubMed 37696954