pVITRO1-HAPPID1
(Plasmid
#204626)
-
PurposeExpresses the human anti-Phl p 7 IgD/λ antibody 102.1F10 (HAPPID1) in mammalian cells. HAPPID1 binds to the grass pollen allergen Phl p 7 with subnanomolar affinity.
-
Depositing Lab
-
Sequence Information
-
Sequences (3) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204626 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepVITRO1-hygro-mcs
-
Backbone manufacturerInvivoGen
- Backbone size w/o insert (bp) 6441
- Total vector size (bp) 8727
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameHAPPID1 heavy chain
-
Alt namehuman anti-Phl p 7 IgD antibody heavy chain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1575
- Promoter mouse elongation factor 1 alpha
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTTTGAGCGGAGCTAATTCTCGGG
- 3′ sequencing primer AAAAAACCTCCCACACCTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHAPPID1 light chain
-
Alt namehuman anti-Phl p 7 IgD antibody light chain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)711
- Promoter rat elongation factor 1 alpha
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAGGCTAATTCTCAAGCCTC
- 3′ sequencing primer TCTAGACCTGGAAAGACCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVITRO1-HAPPID1 was a gift from James McDonnell (Addgene plasmid # 204626 ; http://n2t.net/addgene:204626 ; RRID:Addgene_204626) -
For your References section:
Expanding the Anti-Phl p 7 Antibody Toolkit: An Anti-Idiotype Nanobody Inhibitor. Vester SK, Davies AM, Beavil RL, Sandhar BS, Beavil AJ, Gould HJ, Sutton BJ, McDonnell JM. Antibodies (Basel). 2023 Nov 16;12(4):75. doi: 10.3390/antib12040075. 10.3390/antib12040075 PubMed 37987253