Skip to main content
Addgene

pVITRO1-HAPPID1
(Plasmid #204626)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204626 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pVITRO1-hygro-mcs
  • Backbone manufacturer
    InvivoGen
  • Backbone size w/o insert (bp) 6441
  • Total vector size (bp) 8727
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    HAPPID1 heavy chain
  • Alt name
    human anti-Phl p 7 IgD antibody heavy chain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1575
  • Promoter mouse elongation factor 1 alpha

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTTTGAGCGGAGCTAATTCTCGGG
  • 3′ sequencing primer AAAAAACCTCCCACACCTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    HAPPID1 light chain
  • Alt name
    human anti-Phl p 7 IgD antibody light chain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    711
  • Promoter rat elongation factor 1 alpha

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GAGGCTAATTCTCAAGCCTC
  • 3′ sequencing primer TCTAGACCTGGAAAGACCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVITRO1-HAPPID1 was a gift from James McDonnell (Addgene plasmid # 204626 ; http://n2t.net/addgene:204626 ; RRID:Addgene_204626)
  • For your References section:

    Expanding the Anti-Phl p 7 Antibody Toolkit: An Anti-Idiotype Nanobody Inhibitor. Vester SK, Davies AM, Beavil RL, Sandhar BS, Beavil AJ, Gould HJ, Sutton BJ, McDonnell JM. Antibodies (Basel). 2023 Nov 16;12(4):75. doi: 10.3390/antib12040075. 10.3390/antib12040075 PubMed 37987253