pPV-Dual_promoter-EF1α-2xNLS-Cascade+Cas3-P (RD)
(Plasmid
#204619)
-
PurposeExpression vector of Cascade and Cas3. Puromycin selectable.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPV
- Backbone size w/o insert (bp) 8900
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas7, Cas5, Cas8, Cas11, Cas6, and Cas3
-
SpeciesE. coli
-
Insert Size (bp)7000
- Promoter EF1a
-
Tag
/ Fusion Protein
- Each protein has C- and N-terminal SV40 NLS (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAAATTATACTTATTAGTCAGTC
- 3′ sequencing primer GGTGAGATCTGAATCCAAT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPV-Dual_promoter-EF1α-2xNLS-Cascade+Cas3-P (RD) was a gift from Akitsu Hotta (Addgene plasmid # 204619 ; http://n2t.net/addgene:204619 ; RRID:Addgene_204619) -
For your References section:
CRISPR-Cas3 induces broad and unidirectional genome editing in human cells. Morisaka H, Yoshimi K, Okuzaki Y, Gee P, Kunihiro Y, Sonpho E, Xu H, Sasakawa N, Naito Y, Nakada S, Yamamoto T, Sano S, Hotta A, Takeda J, Mashimo T. Nat Commun. 2019 Dec 6;10(1):5302. doi: 10.1038/s41467-019-13226-x. 10.1038/s41467-019-13226-x PubMed 31811138