pPV-Dual_promoter-EF1α-2xNLS-Cascade+Cas3-P (RD)
(Plasmid #204619)

• Purpose: Expression vector of Cascade and Cas3. Puromycin selectable.
• Depositing Lab: Akitsu Hotta
• Publication: Morisaka et al Nat Commun. 2019 Dec 6;10(1):5302. doi: 10.1038/s41467-019-13226-x.

Backbone

• Vector backbone: pPV
• Backbone size w/o insert (bp): 8900
• Vector type: CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas7, Cas5, Cas8, Cas11, Cas6, and Cas3
• Species: E. coli
• Insert Size (bp): 7000
• Promoter: EF1a
• Tag / Fusion Protein:
  • Each protein has C- and N-terminal SV40 NLS (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CAAATTATACTTATTAGTCAGTC
• 3′ sequencing primer: GGTGAGATCTGAATCCAAT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry