pLKO.3R/MPL-shRNA4
(Plasmid
#204529)
-
PurposeLentiviral expression of MPL-shRNA4; gene knock down of human MPL
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204529 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.3R
-
Backbone manufacturerChristophe Benoist & Diane Mathis (Addgene plasmid # 14748)
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMPL-shRNA4
-
gRNA/shRNA sequenceCCGGCCTCTGGGTGAAGAATGTGTTCTCGAGAACACATTCTTCACCCAGAGGTTTTTG
-
SpeciesH. sapiens (human)
-
Entrez GeneMPL (a.k.a. C-MPL, CD110, MPLV, THCYT2, THPOR, TPOR)
Cloning Information
- Cloning method Ligation Independent Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.3R/MPL-shRNA4 was a gift from Norio Komatsu (Addgene plasmid # 204529 ; http://n2t.net/addgene:204529 ; RRID:Addgene_204529) -
For your References section:
Activation of the thrombopoietin receptor by mutant calreticulin in CALR-mutant myeloproliferative neoplasms. Araki M, Yang Y, Masubuchi N, Hironaka Y, Takei H, Morishita S, Mizukami Y, Kan S, Shirane S, Edahiro Y, Sunami Y, Ohsaka A, Komatsu N. Blood. 2016 Jan 27. pii: blood-2015-09-671172. 10.1182/blood-2015-09-671172 PubMed 26817954