pHIT246
(Plasmid #204507)

• Purpose: csr-1 construct tagged with 2xFLAG for MosSCI integration at locus ttTi5605 on Chr II in nematode
• Depositing Lab: Yuji Kohara
• Publication: Tabara et al EMBO J. 2023 Jun 1;42(11):e105002. doi: 10.15252/embj.2020105002. Epub 2023 Apr 20.

Backbone

• Vector backbone: pCFJ151
• Backbone manufacturer: Addgene #19330
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 2xFLAG::csr-1 (C. elegans)
• Species: C. elegans (nematode)
• Entrez Gene: csr-1 (a.k.a. CELE_F20D12.1)
• Promoter: csr-1 (C. elegans)
• Tag / Fusion Protein:
  • 2xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AflII (unknown if destroyed)
• 3′ cloning site: SgfI (unknown if destroyed)
• 5′ sequencing primer: pCFJ151_near_AflII (CGGGCTACGTAATACGACTCAC)

Resource Information

• Supplemental Documents:
  • pHIT246.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

2xFLAG(M2) tag in this plasmid is DYKDHDAAADYKDDD; pCFJ151 (backborn) was modified to have two copies of I-SceI sites