pET22b 6His SpyCatcher-GRFT
(Plasmid
#204502)
-
PurposeBacterial expression of GRFT with N-terminal SpyCatcher fusion and GS linker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204502 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-22b
- Backbone size w/o insert (bp) 5354
- Total vector size (bp) 6155
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGRFT
-
SpeciesGriffithsia sp.
-
Insert Size (bp)801
-
GenBank ID58200458
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on insert)
- SpyCatcher (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttattaatactgttcataataaatatccaggctatccag
- 3′ sequencing primer CTCTAGATTAACTTTAAGAAGGAGGGTACCatgggtagcagccaccatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET22b 6His SpyCatcher-GRFT was a gift from Urartu Seker (Addgene plasmid # 204502 ; http://n2t.net/addgene:204502 ; RRID:Addgene_204502) -
For your References section:
A Genetically Engineered Biofilm Material for SARS-CoV-2 Capturing and Isolation. Ozkul G, Kehribar ES, Ahan RE, Koksaldi IC, Ozkul A, Dinc B, Aydogan S, Seker UOS. Adv Mater Interfaces. 2022 Sep 13:2201126. doi: 10.1002/admi.202201126. 10.1002/admi.202201126 PubMed 36248312