Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-sL7-Cre-HA-WPRE
(Plasmid #204488)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204488 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5186
  • Total vector size (bp) 6212
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre
  • Species
    Synthetic
  • Insert Size (bp)
    1026
  • Promoter sL7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CATGTTGGTTGATCTTCAAC
  • 3′ sequencing primer AATCAACCTCTGGATTACAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-sL7-Cre-HA-WPRE was a gift from Samuel Wang (Addgene plasmid # 204488 ; http://n2t.net/addgene:204488 ; RRID:Addgene_204488)
  • For your References section:

    Transcriptomic mapping uncovers Purkinje neuron plasticity driving learning. Chen X, Du Y, Broussard GJ, Kislin M, Yuede CM, Zhang S, Dietmann S, Gabel H, Zhao G, Wang SS, Zhang X, Bonni A. Nature. 2022 May;605(7911):722-727. doi: 10.1038/s41586-022-04711-3. Epub 2022 May 11. 10.1038/s41586-022-04711-3 PubMed 35545673