pAAV-sL7-Cre-HA-WPRE
(Plasmid
#204488)
-
PurposeFor production of driver AAV virus for Purkinje cell-specific expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204488 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5186
- Total vector size (bp) 6212
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre
-
SpeciesSynthetic
-
Insert Size (bp)1026
- Promoter sL7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CATGTTGGTTGATCTTCAAC
- 3′ sequencing primer AATCAACCTCTGGATTACAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-sL7-Cre-HA-WPRE was a gift from Samuel Wang (Addgene plasmid # 204488 ; http://n2t.net/addgene:204488 ; RRID:Addgene_204488) -
For your References section:
Transcriptomic mapping uncovers Purkinje neuron plasticity driving learning. Chen X, Du Y, Broussard GJ, Kislin M, Yuede CM, Zhang S, Dietmann S, Gabel H, Zhao G, Wang SS, Zhang X, Bonni A. Nature. 2022 May;605(7911):722-727. doi: 10.1038/s41586-022-04711-3. Epub 2022 May 11. 10.1038/s41586-022-04711-3 PubMed 35545673