pLenti HsATP10B_E210A
(Plasmid
#204475)
-
Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B E210A mutant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204475 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiviral transferplasmid
-
Backbone manufacturerDidier Trono
- Backbone size w/o insert (bp) 11402
- Total vector size (bp) 15803
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATP10B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4386
-
MutationE210A
-
Entrez GeneATP10B (a.k.a. ATPVB)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGACCTTGCATTCCTTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.01.543059 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti HsATP10B_E210A was a gift from Veerle Baekelandt (Addgene plasmid # 204475 ; http://n2t.net/addgene:204475 ; RRID:Addgene_204475) -
For your References section:
The lipid flippase ATP10B enables cellular lipid uptake under stress conditions. Wouters R, Beletchi I, Van den Haute C, Baekelandt V, Martin S, Eggermont J, Vangheluwe P. Biochim Biophys Acta Mol Cell Res. 2024 Feb;1871(2):119652. doi: 10.1016/j.bbamcr.2023.119652. Epub 2023 Dec 11. 10.1016/j.bbamcr.2023.119652 PubMed 38086447