pMZ103-rbs1-m6
(Plasmid
#204468)
-
PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-S129N-L130V mutation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAN871
- Backbone size w/o insert (bp) 5455
-
Modifications to backboneInsert lasR gene after tetR gene
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namequorum sensing regulator LasR
-
Insert Size (bp)720
-
MutationLasR L125W-S129N-L130V mutation
-
Entrez GenelasR (a.k.a. PA1430)
- Promoter In an operon
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer CAGAGCCAGCCTTCTTATTCG
- 3′ sequencing primer CCTGTCAAATGGACGAAGCAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeYFP
-
Insert Size (bp)720
- Promoter PLas
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer TGGCTCATAACACCCCTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMZ103-rbs1-m6 was a gift from Lauren Andrews (Addgene plasmid # 204468 ; http://n2t.net/addgene:204468 ; RRID:Addgene_204468) -
For your References section:
Identifying LasR Quorum Sensors with Improved Signal Specificity by Mapping the Sequence-Function Landscape. Zeng M, Sarker B, Rondthaler SN, Vu V, Andrews LB. ACS Synth Biol. 2024 Feb 16;13(2):568-589. doi: 10.1021/acssynbio.3c00543. Epub 2024 Jan 11. 10.1021/acssynbio.3c00543 PubMed 38206199