Skip to main content
Addgene

pMZ103-rbs1-m5
(Plasmid #204467)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204467 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAN871
  • Backbone size w/o insert (bp) 5455
  • Modifications to backbone
    Insert lasR gene after tetR gene
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    quorum sensing regulator LasR
  • Insert Size (bp)
    720
  • Mutation
    LasR L125F-A127G-S129N mutation
  • Entrez Gene
    lasR (a.k.a. PA1430)
  • Promoter In an operon

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CAGAGCCAGCCTTCTTATTCG
  • 3′ sequencing primer CCTGTCAAATGGACGAAGCAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    eYFP
  • Insert Size (bp)
    718
  • Promoter PLas

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer TGGCTCATAACACCCCTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMZ103-rbs1-m5 was a gift from Lauren Andrews (Addgene plasmid # 204467 ; http://n2t.net/addgene:204467 ; RRID:Addgene_204467)
  • For your References section:

    Identifying LasR Quorum Sensors with Improved Signal Specificity by Mapping the Sequence-Function Landscape. Zeng M, Sarker B, Rondthaler SN, Vu V, Andrews LB. ACS Synth Biol. 2024 Feb 16;13(2):568-589. doi: 10.1021/acssynbio.3c00543. Epub 2024 Jan 11. 10.1021/acssynbio.3c00543 PubMed 38206199