Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUCXMG
(Plasmid #204409)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204409 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUCX
  • Backbone manufacturer
    Addgene #60681
  • Backbone size (bp) 4191
  • Modifications to backbone
    The pUCXMG vector was generated from the pUCX vector backbone with a replacement of the ampicillin resistance marker by a gentamycin resistance cassette and introduction of a modified multiple-cloning site, containing a His6 tag and a downstream NcoI restriction site. For replacement of the antibiotic resistance gene, the pUCX vector was amplified with forward primer CTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAAC and reverse primer ACTCTTCCTTTTTCAATATTATTGAAGC and assembled with a synthetic gentamycin cassette ordered from Twist Bioscience containing 5’ and 3’ 20-bp pUCX homology arms, using NEBuilder® HiFi DNA Assembly (New England Biolabs). A synthetic cloning site comprising an NcoI recognition sequence flanked by XbaI and HindIII restriction sites was ordered from Twist Bioscience and used to replace the XbaI-HindIII region of the pUCX multiple cloning site by restriction cloning.
  • Vector type
    Bacterial Expression
  • Promoter tac
  • Tag / Fusion Protein
    • His6 (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUCXMG was a gift from David Ackerley (Addgene plasmid # 204409 ; http://n2t.net/addgene:204409 ; RRID:Addgene_204409)
  • For your References section:

    A metagenomic library cloning strategy that promotes high-level expression of captured genes to enable efficient functional screening. Rich MH, Sharrock AV, Mulligan TS, Matthews F, Brown AS, Lee-Harwood HR, Williams EM, Copp JN, Little RF, Francis JJ, Horvat CN, Stevenson LJ, Owen JG, Saxena MT, Mumm JS, Ackerley DF. bioRxiv. 2023 Mar 25:2023.03.24.534183. doi: 10.1101/2023.03.24.534183. Preprint. 10.1101/2023.03.24.534183 PubMed 36993673