pET28C-mCherry-YTHDF2
(Plasmid #204406)

• Purpose: E. coli expression of full-length YTHDF2 with an N-terminal mCherry tag
• Depositing Lab: Samie Jaffrey
• Publication: Dumelie et al Nat Chem Biol. 2023 Nov 16. doi: 10.1038/s41589-023-01474-4.

Backbone

• Vector backbone: pET28C(+)
• Backbone manufacturer: Novagen (EMD Millipore)
• Backbone size w/o insert (bp): 5369
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YTHDF2
• Species: H. sapiens (human)
• Insert Size (bp): 2455
• Entrez Gene: YTHDF2 (a.k.a. CAHL, DF2, HGRG8, NY-REN-2)
• Promoter: T7
• Tag / Fusion Protein:
  • 6x-His; mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (destroyed during cloning)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene #102275
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry