Skip to main content
Addgene

pMZ3012
(Plasmid #204400)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204400 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNH4
  • Backbone size w/o insert (bp) 6429
  • Total vector size (bp) 8186
  • Modifications to backbone
    This is a shuttle vector containing AmyE homologous arms for integration into B. subtilis genome.
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    chloramphenicol ( 5 µg/ml) resistant when integrated to B. subtilis genome
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    quorum sensing regulator rhlR
  • Insert Size (bp)
    720
  • Entrez Gene
    rhlR (a.k.a. PA3477)
  • Promoter PftsH

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer NULL
  • 3′ sequencing primer AGATCTTCATCACCGAAACGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GFP
  • Insert Size (bp)
    717
  • Promoter Synthetic promoter PRhl0L0L12

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GACAAATCCGCCGCTCTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMZ3012 was a gift from Lauren Andrews (Addgene plasmid # 204400 ; http://n2t.net/addgene:204400 ; RRID:Addgene_204400)
  • For your References section:

    Synthetic Homoserine Lactone Sensors for Gram-Positive Bacillus subtilis Using LuxR-Type Regulators. Zeng M, Sarker B, Howitz N, Shah I, Andrews LB. ACS Synth Biol. 2023 Dec 11. doi: 10.1021/acssynbio.3c00504. 10.1021/acssynbio.3c00504 PubMed 38079538