Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMZ1001
(Plasmid #204398)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204398 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNH4
  • Backbone size w/o insert (bp) 6429
  • Total vector size (bp) 8197
  • Modifications to backbone
    This is a shuttle vector containing AmyE homologous arms for integration into B. subtilis genome.
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    chloramphenicol ( 5 µg/ml) resistant when integrated to B. subtilis genome
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    quorum sensing regulator RpaR
  • Insert Size (bp)
    729
  • Entrez Gene
    rpaR (a.k.a. I8G32_RS01665, I8G32_00334)
  • Promoter PftsH

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer NULL
  • 3′ sequencing primer AGATCTTCATCACCGAAACGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GFP
  • Insert Size (bp)
    717
  • Promoter Synthetic promoter PRpa0002

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GACAAATCCGCCGCTCTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMZ1001 was a gift from Lauren Andrews (Addgene plasmid # 204398 ; http://n2t.net/addgene:204398 ; RRID:Addgene_204398)
  • For your References section:

    Synthetic Homoserine Lactone Sensors for Gram-Positive Bacillus subtilis Using LuxR-Type Regulators. Zeng M, Sarker B, Howitz N, Shah I, Andrews LB. ACS Synth Biol. 2023 Dec 11. doi: 10.1021/acssynbio.3c00504. 10.1021/acssynbio.3c00504 PubMed 38079538