Skip to main content
Addgene

pAAV-hSyn-miniDi-P2A-mCherry
(Plasmid #204358)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204358 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miniDi-P2A-mCherry
  • Alt name
    hM4Di-ICL3_176 DREADD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1746
  • Mutation
    The third intracellular loop (ICL3) of hM4Di was substituted with a 5-amino-acid peptide sequence Q-N-T-I-S derived from hGpr176 ICL3.
  • Promoter hSyn
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer aactccccttcccggccaccttg
  • 3′ sequencing primer ctatgttgctccttttacgctatg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene (#44362, #135391)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-miniDi-P2A-mCherry was a gift from Masao Doi (Addgene plasmid # 204358 ; http://n2t.net/addgene:204358 ; RRID:Addgene_204358)
  • For your References section:

    Size-reduced DREADD derivatives for AAV-assisted multimodal chemogenetic control of neuronal activity and behavior. Miyake T, Tanaka K, Inoue Y, Nagai Y, Nishimura R, Seta T, Nakagawa S, Inoue K, Hasegawa E, Minamimoto T, Doi M. Cell Reports Methods, Volume 4, Issue 10, 100881, October 21, 2024 10.1016/j.crmeth.2024.100881