pAAV-hSyn-miniDq-P2A-mCherry
(Plasmid #204357)

• Purpose: AAV vector for miniDq expression under the control of human synapsin promoter
• Depositing Lab: Masao Doi
• Publication: Miyake et al Cell Reports Methods, Volume 4, Issue 10, 100881, October 21, 2024

Backbone

• Vector backbone: pAAV
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: miniDq-P2A-mCherry
• Alt name: hM3Dq-ICL3_176 DREADD
• Species: H. sapiens (human)
• Insert Size (bp): 1914
• Mutation: The third intracellular loop (ICL3) of hM3Dq was substituted with a 5-amino-acid peptide sequence Q-N-T-I-S derived from hGpr176 ICL3.
• Promoter: hSyn
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: aactccccttcccggccaccttg
• 3′ sequencing primer: ctatgttgctccttttacgctatg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene (#44361, #135391)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry