pLenti_PGK_Prkaa1
(Plasmid
#204356)
-
PurposeLentiviral plasmid, Expresses Prkaa1 under the control of the PGK promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti PGK Puro
-
Backbone manufacturer#19068 modified
- Backbone size w/o insert (bp) 7951
- Total vector size (bp) 9631
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAMP-activated protein kinase alpha 1
-
Alt namePrkaa1
-
Alt nameAMPKa1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1680
-
GenBank IDNM_001013367.3
-
Entrez GenePrkaa1 (a.k.a. AMPKalpha1, C130083N04Rik)
- Promoter PGK
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTGTTCCGCATTCTGCAAG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_PGK_Prkaa1 was a gift from Günter Schneider (Addgene plasmid # 204356 ; http://n2t.net/addgene:204356 ; RRID:Addgene_204356)