CLYBL-TO-PAX7
(Plasmid #204346)

• Purpose: Knock-in vector to insert a dox-inducible PAX7 transgene into the CYBL locus in human pluripotent stem cells. PAX7 induction results in myogenic differentiation.
• Depositing Lab: Ivo Lieberam
• Publication: Harley et al Cell Rep. 2023 Dec 26;42(12):113509. doi: 10.1016/j.celrep.2023.113509. Epub 2023 Nov 28.

Backbone

• Vector backbone: pUCM-CLYBL-hNIL
• Backbone manufacturer: Michael Ward - plasmid# 105841
• Backbone size w/o insert (bp): 10040
• Total vector size (bp): 13283
• Modifications to backbone: hNIL genes were replaced by hPAX7 gene. mCherry reporter cassette was removed.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human PAX7
• Species: H. sapiens (human)
• Insert Size (bp): 1557
• GenBank ID: NM_002584
• Promoter: TRE3G

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCCACCCCACAGTGGTTTAC
• 3′ sequencing primer: CAGGAAACAGCTATGAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry