AAVS1-Hb9-CD14
(Plasmid #204344)

• Purpose: Knock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.
• Depositing Lab: Ivo Lieberam
• Publication: Aberrant axon initial segment plasticity and intrinsic excitability of human ALS motor neurons (unpublished)

Backbone

• Vector backbone: AAVS1-CAG-hrGFP
• Backbone manufacturer: Su-Chun Zhang - plasmid# 52344
• Backbone size w/o insert (bp): 7100
• Total vector size (bp): 18000
• Modifications to backbone: The Not1 site in the backbone was deleted, and the CAG-hrGFP sequence was removed. The original insert was replaced by the 9kb Hb9 promoter (PMID: 10482234), a 5' splice substrate (PMID: 2038318), the human CD14 gene (PMID: 24496616) and the bGH-poly-A signal (PMID: 6146135). This entire cassette can be excised by Not1/Pac1 digest.
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human CD14
• Species: H. sapiens (human)
• Insert Size (bp): 1159
• GenBank ID: NM_000591
• Entrez Gene: CD14
• Promoter: mouse Hb9 (Mnx1) 9kb promoter fragment

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Age1 (not destroyed)
• 3′ cloning site: Spe1 (not destroyed)
• 5′ sequencing primer: TGGAAGGTGCCACTCCCACTGT
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry