Skip to main content
Addgene

AAVS1-Hb9-CD14
(Plasmid #204344)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204344 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAVS1-CAG-hrGFP
  • Backbone manufacturer
    Su-Chun Zhang - plasmid# 52344
  • Backbone size w/o insert (bp) 7100
  • Total vector size (bp) 18000
  • Modifications to backbone
    The Not1 site in the backbone was deleted, and the CAG-hrGFP sequence was removed. The original insert was replaced by the 9kb Hb9 promoter (PMID: 10482234), a 5' splice substrate (PMID: 2038318), the human CD14 gene (PMID: 24496616) and the bGH-poly-A signal (PMID: 6146135). This entire cassette can be excised by Not1/Pac1 digest.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human CD14
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1159
  • GenBank ID
    NM_000591
  • Entrez Gene
    CD14
  • Promoter mouse Hb9 (Mnx1) 9kb promoter fragment

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (not destroyed)
  • 3′ cloning site Spe1 (not destroyed)
  • 5′ sequencing primer TGGAAGGTGCCACTCCCACTGT
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-Hb9-CD14 was a gift from Ivo Lieberam (Addgene plasmid # 204344 ; http://n2t.net/addgene:204344 ; RRID:Addgene_204344)

  • For your References section:

    Aberrant axon initial segment plasticity and intrinsic excitability of ALS hiPSC motor neurons. Harley P, Kerins C, Gatt A, Neves G, Riccio F, Machado CB, Cheesbrough A, R'Bibo L, Burrone J, Lieberam I. Cell Rep. 2023 Dec 26;42(12):113509. doi: 10.1016/j.celrep.2023.113509. Epub 2023 Nov 28. 10.1016/j.celrep.2023.113509 PubMed 38019651
Related items: