Skip to main content
Addgene

pUDE1093
(Plasmid #204227)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204227 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGGKd018
  • Backbone manufacturer
    Randazzo P, Bennis NX, Daran JM, Daran-Lapujade P. gEL DNA: A Cloning- and Polymerase Chain Reaction-Free Method for CRISPR-Base
  • Total vector size (bp) 9495
  • Modifications to backbone
    Assembled by golden gate cloning
  • Vector type
    Yeast Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Eubacterium rectale cas12a (Ercas12a)
  • Alt name
    MAD7
  • Species
    Synthetic; Eubacterium rectale
  • Insert Size (bp)
    3789
  • Mutation
    codon optimized for S. cerevisiae
  • GenBank ID
    MH347339.1
  • Promoter Saccharomyces cerevisiae PGK1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer ATGAACAACGGTACTAACAACTTCC
  • 3′ sequencing primer TTACACCTTCCTCTTCTTCTTGG
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The original Ercas12a gene sequence was retrieved from Inscripta Inc. (https://www.inscripta.com/products/madzymes-nucleases, consulted April 2020, WP_055225123.1).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUDE1093 was a gift from Jean-Marc Daran (Addgene plasmid # 204227 ; http://n2t.net/addgene:204227 ; RRID:Addgene_204227)

  • For your References section:

    Expanding the genome editing toolbox of Saccharomyces cerevisiae with the endonuclease ErCas12a. Bennis NX, Anderson JP, Kok SMC, Daran JG. FEMS Yeast Res. 2023 Jan 4;23:foad043. doi: 10.1093/femsyr/foad043. 10.1093/femsyr/foad043 PubMed 37791490
Related items: