Skip to main content
Addgene

pC178: pAAV.U6.SapI.CMV.Cas13bt3
(Plasmid #204215)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204215 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV.CMV.BGHpA
  • Modifications to backbone
    Insert Cas13bt3 and U6.SapI cloning site
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas13bt3 and U6.SapI sgRNA cloning site
  • Species
    Ruminococcus flavefaciens XPD3002
  • Insert Size (bp)
    2403
  • Mutation
    Codon optimisation by GenScript tool
  • Promoter CMV/U6
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • NLS (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

hU6-driven expression of guide RNAs compatible with Cas13e. Contains SapI sites for guide cloning flanked by 5' and 3' full-length DRs.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC178: pAAV.U6.SapI.CMV.Cas13bt3 was a gift from Guei-Sheung Liu (Addgene plasmid # 204215 ; http://n2t.net/addgene:204215 ; RRID:Addgene_204215)

  • For your References section:

    Characterization of RNA editing and gene therapy with a compact CRISPR-Cas13 in the retina. Kumar S, Hsiao YW, Wong VHY, Aubin D, Wang JH, Lisowski L, Rakoczy EP, Li F, Alarcon-Martinez L, Gonzalez-Cordero A, Bui BV, Liu GS. Proc Natl Acad Sci U S A. 2024 Nov 5;121(45):e2408345121. doi: 10.1073/pnas.2408345121. Epub 2024 Oct 30. 10.1073/pnas.2408345121 PubMed 39475642
Related items: