pLenti-tetON-NKX2-1(delDBD)-EF1a-TagRFP-2A-tet3G
(Plasmid
#204214)
-
PurposeDoxycycline inducible lentiviral vector for human NKX2-1 (delDBD) overexpression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204214 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHAGE
- Backbone size w/o insert (bp) 8676
- Total vector size (bp) 9613
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNKX2-1
-
Alt nameTTF1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)937
-
MutationDeletion of DNA binding domain (delDBD)
-
GenBank IDNM_001079668
-
Entrez GeneNKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)
- Promoter TetON
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGTCGATGAGTCCAAAGCACACG
- 3′ sequencing primer TCACCAGGTCCGACCGTATAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-tetON-NKX2-1(delDBD)-EF1a-TagRFP-2A-tet3G was a gift from Emma Rawlins (Addgene plasmid # 204214 ; http://n2t.net/addgene:204214 ; RRID:Addgene_204214) -
For your References section:
Organoid modeling of human fetal lung alveolar development reveals mechanisms of cell fate patterning and neonatal respiratory disease. Lim K, Donovan APA, Tang W, Sun D, He P, Pett JP, Teichmann SA, Marioni JC, Meyer KB, Brand AH, Rawlins EL. Cell Stem Cell. 2023 Jan 5;30(1):20-37.e9. doi: 10.1016/j.stem.2022.11.013. Epub 2022 Dec 8. 10.1016/j.stem.2022.11.013 PubMed 36493780