Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-tetON-NKX2-1-I207F -EF1a-TagRFP-2A-tet3G
(Plasmid #204212)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204212 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHAGE
  • Backbone size w/o insert (bp) 8676
  • Total vector size (bp) 9792
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NK2 homeobox 1
  • Alt name
    TTF1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1116
  • GenBank ID
    NM_001079668
  • Entrez Gene
    NKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)
  • Promoter TetON
  • Tag / Fusion Protein
    • Point mutation on I207F

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGTCGATGAGTCCAAAGCACACG
  • 3′ sequencing primer TCACCAGGTCCGACCGTATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-tetON-NKX2-1-I207F -EF1a-TagRFP-2A-tet3G was a gift from Emma Rawlins (Addgene plasmid # 204212 ; http://n2t.net/addgene:204212 ; RRID:Addgene_204212)
  • For your References section:

    Organoid modeling of human fetal lung alveolar development reveals mechanisms of cell fate patterning and neonatal respiratory disease. Lim K, Donovan APA, Tang W, Sun D, He P, Pett JP, Teichmann SA, Marioni JC, Meyer KB, Brand AH, Rawlins EL. Cell Stem Cell. 2023 Jan 5;30(1):20-37.e9. doi: 10.1016/j.stem.2022.11.013. Epub 2022 Dec 8. 10.1016/j.stem.2022.11.013 PubMed 36493780