pRegev_ExonSkip_Backbone
(Plasmid #204187)

• Purpose: Backbone for cloning splicing library with truncated CAG promoter and first half of beta globin minigene reporter (exon 1 and intron 1).
• Depositing Lab: Oded Regev
• Publication: Liao et al Proc Natl Acad Sci U S A. 2023 Oct 10;120(41):e2221165120. doi: 10.1073/pnas.2221165120. Epub 2023 Oct 5.

Backbone

• Vector backbone: (None)
• Total vector size (bp): 7524
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: First exon and intron for beta globin splicing minigene
• Species: Synthetic
• Insert Size (bp): 234
• Promoter: Truncated CAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pRegev_ExonSkip_Backbone.gbk
• A portion of this plasmid was derived from a plasmid made by: Minigene design from Kristen Lynch (SA Smith and KW Lynch, "Cell-based splicing of minigenes." (2014)). Backbone design modified from Georg Seelig (AB Rosenberg et al, "Learning the sequence determinants of alternative splicing from millions of random sequences." (2015)).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry